Hey Scholars,
We are cruisin along.... This week we are discussion RNA and its involvement with Protein Synthesis. Proteins are what makes cells so different from one another and allow for cell specialization. It takes transcription and translation to construct these proteins and it involves alot of codons (set of three nitrogen bases) to do so. For this weeks post create your own coded message using the decoder handout that I gave in class on Wednesday. Keep it scholarly.
Mr. D
Subscribe to:
Post Comments (Atom)
4 comments:
GGGAUCGCUCGUGUUGACUUCCACGAGUGCGCCAUGGUG
White Oak Pride
CUGUGUGCCUUUAAAAAGGUCGCCUGGCGCACUGUAAAAUUCAACGUAUGA
uguguauuuauggcaaaacca cuaugugauagaacaguaugcugg ccaugugcaaac
-Mimi
ill write one on monday when i get my notebook back. thats where the paper is.
Post a Comment